1Department of Medical Microbiology and Immunology, Faculty of Medicine, University of Alexandria, Alexandria Governorate, Egypt
2Department of Critical Care Medicine, Faculty of Medicine, Alexandria University, Egypt
Copyright © 2023 The Korean Society of Critical Care Medicine
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
CONFLICT OF INTEREST
No potential conflict of interest relevant to this article was reported.
FUNDING
None.
AUTHOR CONTRIBUTIONS
Conceptualization: SAE, SMA. Data curation: SMA, SAE, GMS, AME. Formal analysis: SMA, SLA, AME. Methodology: SE, SMA, SLA, AME. Writing–original draft: all authors. Writing–review & editing: all authors.
Values are presented as number (%) unless otherwise indicated.
ICU: intensive care unit; COPD: chronic obstructive pulmonary disease; RTA: road traffic accident; APACHE: Acute Physiology and Chronic Health Evaluation; SD: standard deviation; IQR: interquartile range; IVC: intravenous peripheral catheter; UC: urinary catheter; CVC: central venous catheter; MV: mechanical ventilation.
| Gut microbiome | P-HAI (n=8) | N-HAI (n=12) | Control (n=30) | Significance between groups |
|---|---|---|---|---|
| Firmicutes | P1=0.759 | |||
| Median | 0.167 | 0.169 | 0.495 | P2=0.003 |
| IQR | 7.90E-2–2.98E-1 | 8.48E-2–4.47E-1 | 4.18E-1–6.50E-1 | P3=0.002a) |
| Bacteroidetes | P=0.264 | |||
| Median | 0.63 | 0.374 | 0.345 | |
| IQR | 4.19E-1–7.35E-1 | 1.20E-1–6.27E-1 | 2.31E-1–6.37E-1 | |
| Prevotella | P1=0.405 | |||
| Median | 0.00818 | 0.0034 | 0.0462 | P2=0.022 |
| IQR | 8.12E-4–2.42E-2 | 7.94E-4–6.95E-3 | 1.74E-2–8.47E-2 | P3<0.001 |
| Bacteroides | P1=0.115 | |||
| Median | 0.569 | 0.167 | 0.109 | P2=0.002 |
| IQR | 3.07E-1–6.61E-1 | 7.43E-2–6.39E-1 | 6.50E-2–2.00E-1 | P3=0.138 |
| Ruminococcus | P1=0.456 | |||
| Median | 0.00362 | 0.00516 | 0.0467 | P2=0.003 |
| IQR | 6.34E-5–1.05E-2 | 7.27E-4–6.83E-2 | 2.05E-2–1.02E-1 | P3=0.016 |
| Bifidobacterium | P1=0.452 | |||
| Median | 0.000603 | 0.00254 | 0.0237 | P2=0.008 |
| IQR | 1.66E-4–1.70E-2 | 1.14E-3–1.96E-2 | 8.56E-3–5.05E-2 | P3=0.035 |
| Lactobacilli | P=0.066a) | |||
| Median | 0.00457 | 0.0332 | 0.00185 | |
| IQR | 1.51E-3–1.04E-1 | 1.05E-2–6.60E-2 | 4.79E-4–3.44E-2 | |
| Akkermansia muciniphila | P=0.152a) | |||
| Median | 0.0495 | 0.0022 | 0.00301 | |
| IQR | 1.80E-4–2.48E-1 | 3.72E-4–2.93E-2 | 9.58E-4–1.84E-2 | |
| Faecalibacterium | P1=0.970 | |||
| Median | 0.0031 | 0.00227 | 0.215 | P2<0.001 |
| IQR | 7.01E-5–1.06E-2 | 1.23E-4–3.18E-2 | 7.95E-2–3.04E-1 | P3<0.001 |
| Clostridioides difficile | - | |||
| Median | 0 | 0 | 0 | |
| IQR | 0 | 0 | 0 | |
| F/B ratio | P1=0.030 | |||
| Median | 0.31 | 0.83 | 1.44 | P2=0.001 |
| IQR | 0.15–0.73 | 0.29–3.55 | 10.90–2.18 | P3=0.274 |
| P/B ratio | P1=0.915 | |||
| Median | 0.03 | 0.02 | 0.26 | P2=0.002 |
| IQR | 0.002–0.13 | 0.003–0.08 | 0.17–1.48 | P3<0.001 |
| Diversity index | P1=0.456 | |||
| Median | 1.29 | 1.33 | 1.57 | P2=0.027 |
| IQR | 1.07–1.60 | 1.18–1.38 | 1.52–1.66 | P3<0.001 |
| Dissimilarity index | P1<0.001a) | |||
| Median | 28.90 | 41.75 | 0.0 | |
| IQR | 25.50–44.50 | 30.20–58.95 | 0.0–0.0 |
P-HAI: positive for hospital-associated infections; N-HAI: negative for hospital-associated infections; IQR: interquartile range; P1: P-value for comparing between P-HAI and N-HAI; P2: P-value for comparing between P-HAI and Control; P3: P-value for comparing between N-HAI and Control.
a)P: P-value for comparing between the studied groups (If it was a significant value <0.05 ,test significance was done between subgroups, if not, P1, P2, and P3 were considered as <0.05).
| ICU patient (n=20) | Control (n=30) | Monte Carlo P-value | |
|---|---|---|---|
| Enterotype | 0.017 | ||
| 1 | 19 (95.0) | 18 (60.0) | |
| 2 | 1 (5.0) | 9 (30.0) | |
| 3 | 0 | 3 (10.0) |
| Target | Primer name | Primer sequence (5'-3') |
|---|---|---|
| Total bacteria | UnivF | TCCTACGGGAGGCAGCAGT |
| UnivR | GGACTACCAGGGTATCTATCCTGTT | |
| Akkermansia muciniphila | AM1-F | CAG CAC GTG AAG GTG GGG AC |
| AM2-R | CCT TGC GGT TGG CTT CAG AT | |
| Bacteroides | B3F | CGATGGATAGGGGTTCTGAGAGGA |
| B3R | GCTGGCACGGAGTTAGCCGA | |
| Bacteroidetes | Bact934F | GGARCATGTGGTTTATTCGATGAT |
| Bact1060R | AGCTGACGACAACCATGCAG | |
| Bifidobacterium | Bif-F | TCGCGTC(C/T) GGTGTGAAAG |
| Bif-R | CCACATCCAGC(A/G) TCCAC | |
| Faecalibacterium prausnitzii | FPR-2F | GGAGGAAGAAGGTCTTCGG |
| Fprau645R | AATTCCGCCTACCTCTGCACT | |
| Firmicutes | Firm934F | GGAGYATGTGGTTTAATTCGAAGCA |
| Firm1060R | AGCTGACGACAACCATGCAC | |
| Lactobacilli | Lacto-F | AGCAGTAGGGAATCTTCCA |
| Lacto-R | CACCGCTACACATGGAG | |
| Prevotella | PrevF | CACCAAGGCGACGATCA |
| PrevR | GGATAACGCCYGGACCT | |
| Ruminococcus | Rflbr730F | GGCGGCYTRCTGGGCTTT |
| Clep866mR | CCAGGTGGATWACTTATTGTGTTAA |
| Variable | ICU patient (n=20) | Control (n=30) | P-value |
|---|---|---|---|
| Sex | 1.000 | ||
| Male | 8 (40.0) | 12 (40.0) | |
| Female | 12 (60.0 | 18 (60.0) | |
| Age (yr) | 0.858 | ||
| Mean±SD (range) | 51.85±22.73 (18.0–80.0) | 52.53±17.84 (23.0–81.0) | |
| Median (IQR) | 60.0 (29.0–68.0) | 58.0 (32.0–64.0) | |
| BMI (kg/m2) | 0.797 | ||
| Mean±SD (range) | 28.27±2.90 (24.69–34.89) | 28.77±5.31 (19.84–46.90) | |
| Median (IQR) | 27.73 (25.9–30.6) | 27.33 (25.4–32.1) |
| Admission diagnosis | Value |
|---|---|
| Cardiopulmonary disease | 3 (15.0) |
| Cardiogenic shock | 1 (5.0) |
| COPD | 1 (5.0) |
| Myocardial infarction | 1 (5.0) |
| Cerebrovascular accident | 14 (70) |
| Drug intoxication | 3 (15.0) |
| Noninfectious encephalopathy | 1 (5.0) |
| Ischemic stroke | 5 (25.0) |
| Epileptic seizures | 1 (5.0) |
| RTA with head concussion | 4 (20.0) |
| Others | 3 (15) |
| Uremia | 1 (5.0) |
| Hematemesis | 1 (5.0) |
| Postoperative | 1 (5.0) |
| APACHE II score | |
| Mean±SD (range) | 13.25±4.56 (7.0–21.0) |
| Median (IQR) | 12.0 (9.0–17.0) |
| Type of devices | |
| IVC | 20 (100.0) |
| UC | 20 (100.0) |
| CVC | 15 (75.0) |
| MV | 13 (65.0) |
| Gut microbiome | ICU patient (n=20) | Control (n=30) | P-value |
|---|---|---|---|
| Firmicutes | 1.69E-1 (8.48E-2–3.41E-1) | 4.95E-1 (4.18E-1–6.50E-1) | <0.001 |
| Bacteroidetes | 5.14E-1 (2.20E-1–7.14E-1) | 3.45E-1 (2.31E-1–6.37E-1) | 0.513 |
| Prevotella | 3.69E-3 (7.94E-4–1.20E-2) | 4.62E-2 (1.74E-2–8.47E-2) | <0.001 |
| Bacteroides | 3.74E-1 (1.20E-1–6.53E-1) | 1.09E-1 (6.50E-2–2.00E-1) | 0.006 |
| Ruminococcus | 4.25E-3 (4.03E-4–3.81E-2) | 4.67E-2 (2.05E-2–1.02E-1) | 0.001 |
| Bifidobacterium | 2.03E-3 (4.67E-4–1.77E-2) | 2.37E-2 (8.56E-3–5.05E-2) | 0.003 |
| Lactobacilli | 1.92E-2 (2.59E-3–8.60E-2) | 1.85E-3 (4.79E-4–3.44E-2) | 0.025 |
| Akkermansia muciniphila | 2.20E-3 (2.54E-4–1.67E-1) | 3.01E-3 (9.58E-4–1.84E-2) | 0.828 |
| Faecalibacterium | 2.60E-3 (7.18E-5–2.22E-2) | 2.15E-1 (7.95E-2–3.04E-1) | <0.001 |
| Clostridioides difficile | 0.00E+00 (0.00E+00) | 0.00E+00 (0.00E+00) | - |
| F/B ratio | 0.33 (0.25–1.76) | 1.44 (0.90–2.18) | 0.008 |
| P/B ratio | 0.02 (0.002–0.08) | 0.26 (0.17–1.48) | <0.001 |
| Diversity index | 1.33 (1.15–1.46) | 1.57 (1.52–1.66) | <0.001 |
| Dissimilarity index | 35.70 (26.0–53.45) | 0.0 (0.0–0.0) | <0.001 |
| Gut microbiome | P-HAI (n=8) | N-HAI (n=12) | Control (n=30) | Significance between groups |
|---|---|---|---|---|
| Firmicutes | P1=0.759 | |||
| Median | 0.167 | 0.169 | 0.495 | P2=0.003 |
| IQR | 7.90E-2–2.98E-1 | 8.48E-2–4.47E-1 | 4.18E-1–6.50E-1 | P3=0.002a) |
| Bacteroidetes | P=0.264 | |||
| Median | 0.63 | 0.374 | 0.345 | |
| IQR | 4.19E-1–7.35E-1 | 1.20E-1–6.27E-1 | 2.31E-1–6.37E-1 | |
| Prevotella | P1=0.405 | |||
| Median | 0.00818 | 0.0034 | 0.0462 | P2=0.022 |
| IQR | 8.12E-4–2.42E-2 | 7.94E-4–6.95E-3 | 1.74E-2–8.47E-2 | P3<0.001 |
| Bacteroides | P1=0.115 | |||
| Median | 0.569 | 0.167 | 0.109 | P2=0.002 |
| IQR | 3.07E-1–6.61E-1 | 7.43E-2–6.39E-1 | 6.50E-2–2.00E-1 | P3=0.138 |
| Ruminococcus | P1=0.456 | |||
| Median | 0.00362 | 0.00516 | 0.0467 | P2=0.003 |
| IQR | 6.34E-5–1.05E-2 | 7.27E-4–6.83E-2 | 2.05E-2–1.02E-1 | P3=0.016 |
| Bifidobacterium | P1=0.452 | |||
| Median | 0.000603 | 0.00254 | 0.0237 | P2=0.008 |
| IQR | 1.66E-4–1.70E-2 | 1.14E-3–1.96E-2 | 8.56E-3–5.05E-2 | P3=0.035 |
| Lactobacilli | P=0.066 |
|||
| Median | 0.00457 | 0.0332 | 0.00185 | |
| IQR | 1.51E-3–1.04E-1 | 1.05E-2–6.60E-2 | 4.79E-4–3.44E-2 | |
| Akkermansia muciniphila | P=0.152 |
|||
| Median | 0.0495 | 0.0022 | 0.00301 | |
| IQR | 1.80E-4–2.48E-1 | 3.72E-4–2.93E-2 | 9.58E-4–1.84E-2 | |
| Faecalibacterium | P1=0.970 | |||
| Median | 0.0031 | 0.00227 | 0.215 | P2<0.001 |
| IQR | 7.01E-5–1.06E-2 | 1.23E-4–3.18E-2 | 7.95E-2–3.04E-1 | P3<0.001 |
| Clostridioides difficile | - | |||
| Median | 0 | 0 | 0 | |
| IQR | 0 | 0 | 0 | |
| F/B ratio | P1=0.030 | |||
| Median | 0.31 | 0.83 | 1.44 | P2=0.001 |
| IQR | 0.15–0.73 | 0.29–3.55 | 10.90–2.18 | P3=0.274 |
| P/B ratio | P1=0.915 | |||
| Median | 0.03 | 0.02 | 0.26 | P2=0.002 |
| IQR | 0.002–0.13 | 0.003–0.08 | 0.17–1.48 | P3<0.001 |
| Diversity index | P1=0.456 | |||
| Median | 1.29 | 1.33 | 1.57 | P2=0.027 |
| IQR | 1.07–1.60 | 1.18–1.38 | 1.52–1.66 | P3<0.001 |
| Dissimilarity index | P1<0.001 |
|||
| Median | 28.90 | 41.75 | 0.0 | |
| IQR | 25.50–44.50 | 30.20–58.95 | 0.0–0.0 |
| ICU patient (n=20) | Control (n=30) | Monte Carlo P-value | |
|---|---|---|---|
| Enterotype | 0.017 | ||
| 1 | 19 (95.0) | 18 (60.0) | |
| 2 | 1 (5.0) | 9 (30.0) | |
| 3 | 0 | 3 (10.0) |
Values are presented as number (%) or unless otherwise indicated. ICU: intensive care unit; SD: standard deviation; IQR: interquartile range; BMI: body mass index.
Values are presented as number (%) unless otherwise indicated. ICU: intensive care unit; COPD: chronic obstructive pulmonary disease; RTA: road traffic accident; APACHE: Acute Physiology and Chronic Health Evaluation; SD: standard deviation; IQR: interquartile range; IVC: intravenous peripheral catheter; UC: urinary catheter; CVC: central venous catheter; MV: mechanical ventilation.
Values are presented as median (interquartile range). ICU: intensive care unit; F/B:
P-HAI: positive for hospital-associated infections; N-HAI: negative for hospital-associated infections; IQR: interquartile range; P1: P-value for comparing between P-HAI and N-HAI; P2: P-value for comparing between P-HAI and Control; P3: P-value for comparing between N-HAI and Control. P: P-value for comparing between the studied groups (If it was a significant value <0.05 ,test significance was done between subgroups, if not, P1, P2, and P3 were considered as <0.05).
Values are presented as number (%). ICU: intensive care unit.